glnL [2019-08-27 10:14:08]

two-component response regulator, regulation of the glsA-glnT operon

Locus: BSU_02450

Isoelectric point: 7.02

Molecular weight: 35.56 kDa

Protein length: 314 aa

Gene length: 945 bp

Function: regulation of the glsA-glnT operon

Product: two-component response regulator

Essential: no

Synonyms: ycbB, yzgB

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of glutamine/ glutamate
• Information processing → Regulation of gene expression → Transcription factors and their control → Two-component system response regulators
• Groups of genes → Phosphoproteins → Phosphorylation on an Asp residue

Gene

Coordinates: 266,719 267,663

The protein

Modification

• phosphorylated by GlnK on an Asp residue

Effectors of protein activity

• phosphorylation likely affects DNA-binding activity

Localization

• cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: glnK-glnL
  Description: PubMed

Biological materials

Mutant

• MGNA-C026 (ycbB::erm), available at the NBRP B. subtilis, Japan
• BKE02450 (glnL::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGCTTTTGGTTCACCCT, downstream forward: _UP4_TAAACCAAACAGCCGGCTGA
• BKK02450 (glnL::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAGCTTTTGGTTCACCCT, downstream forward: _UP4_TAAACCAAACAGCCGGCTGA

References

Loading